Pevonedistat attenuates cisplatin‐induced nephrotoxicity in mice by downregulating the release of inflammatory mediators

Yousra M. El‐Far | Mohamed El‐Mesery

Abstract
Pevonedistat (MLN4924) is a specific NEDD8‐activating enzyme inhibitor that in- activates cullin–RING ligases involved in ubiquitylation and turnover of different signaling molecules. In the current study, we evaluated the effect of pevonedistat on cisplatin (CIS)‐induced nephrotoxicity in mice. Serum creatinine and urea levels were analyzed in different groups. Histopathological examination of renal tissue was done using hematoxylin and eosin staining. In addition, renal IL‐6 and TNF‐α expressions were analyzed using the enzyme‐linked immunosorbent assay technique, and IL‐1β and NF‐κB expressions were analyzed by immunohistochemical staining of renal tissue. Caspase‐3, A20, β‐catenin, and Nrf2 gene expressions in renal tissue were analyzed using the reverse‐transcription polymerase chain reaction technique. Western blot analysis was adopted to assess cleaved caspase‐3 and β‐catenin ex- pressions in renal tissue. Pevonedistat coadministration with CIS improved kidney functions and attenuated CIS‐induced nephrotoxicity as indicated by the significant decrease in serum creatinine and urea levels. In addition, pevonedistat coadminis- tration with CIS showed a significant decrease in caspase‐3 and a significant increase in A20, β‐catenin, and Nrf2 gene expressions. Also, pevonedistat decreased caspase‐ 3 cleavage to p19 in mice treated with CIS. Moreover, pevonedistat decreased CIS‐ induced upregulation of IL‐6, TNF‐α, IL‐1β, and NF‐κB protein expressions in renal tissue. Thus, pevonedistat alleviated CIS‐induced nephrotoxicity that might be at- tributed to suppression of the inflammation induced in renal tissue.

KE YWO R DS
caspase‐3, cisplatin, inflammation, nephrotoxicity, pevonedistat
Department of Biochemistry, Faculty of Pharmacy, Mansoura University, Mansoura, Egypt

Correspondence
Mohamed El‐Mesery, Department of Biochemistry, Faculty of Pharmacy, Mansoura University, Mansoura 35516, Egypt.
Email: [email protected] and [email protected]

⦁ | INTRODUCTION

Chemotherapy is considered one of the treatments of choice for different cancer patients. However, the inability of chemotherapeutic drugs to discriminate between cancer and normal cells leads to the fact that cancer patients under the course of treatment suffer from
several side effects.[1–4] Chemotherapeutic drugs are grouped into different classes based on the mechanism of action such as alkylating agents, antimetabolites, nucleoside analogs, and vinca alkaloids.[5] Cisplatin (CIS) is an example of an alkylating agent that is well known for its efficacy in the treatment of different types of solid tumors such as ovarian cancer, bladder cancer, breast cancer, and lung

© 2021 Wiley Periodicals LLC

J Biochem Mol Toxicol. 2021;e22908. wileyonlinelibrary.com/journal/jbt | 1 of 10

https://doi.org/10.1002/jbt.22908

cancer.[6] Unfortunately, treatment with CIS leads to the develop- ment of several side effects in cancer patients such as nephrotoxicity, ototoxicity, cardiotoxicity, and hepatotoxicity.[7]
Nephrotoxicity is considered one of the serious side effects asso- ciated with CIS treatment due to its accumulation in kidney more than in any other organs that represents the main organ of its excretion.[7] In- deed, there are several molecular mechanisms involved in CIS‐induced nephrotoxicities such as induction of oxidative stress, DNA damage, apoptosis induction, and inflammatory response activation.[7–8] Oxidative stress induced by CIS plays a major role in the etiology of nephrotoxicity due to the generation of reactive oxygen species (ROS) in renal tubules.[9–10] Oxidative stress is characterized by the upregulation of lipid oxidation products such as malondialdehyde (MDA) and depletion of antioxidant molecules such as reduced glutathione (GSH). Therefore, several research trials have been directed to evaluate the ability of natural antioxidants to mitigate CIS‐induced nephrotoxicity.[9,11–12]
Cullin–RING ligases (CRLs) are considered the greatest class of E3 ubiquitin ligase.[13] The neddylation process involves the covalent binding of ubiquitin‐like protein known as NEDD8 to CRLs control- ling their activity that requires the activation of E1 NEDD‐activating enzyme (NAE), E2, and E3 NEDD8‐specific enzymes.[14–15] CRLs and the neddylation process play crucial roles in different biological processes by the control of proteasomal degradation of several vital proteins such as regulators of cell cycle and proteins required for DNA replication.[16–17] Based on the previous facts, impairment in the normal neddylation process leads to cancer development of dif- ferent origins.[13,18–19] Therefore, there is no wonder that NAE in- hibition, which is an early step in the neddylation process, is considered an attractive target to develop new anticancer drugs.
Pevonedistat, which is also known as MLN4924, is a recently de- veloped specific NAE inhibitor that induces accumulation of CRLs sub- strates and inhibits the nuclear factor kappa B (NF‐κB) pathway.[20–23] Recently, several studies have been directed to evaluate combination therapies to overcome cancer cell resistance and improve anticancer ef- ficacy.[24–29] Pevonedistat represents a novel candidate for such combi- nation therapies based on the fact that several in vivo and in vitro studies have been conducted to illustrate the anticancer and sensitizing activities of pevonedistat.[20,30–32] Moreover, several clinical trials have been ap- plied to evaluate pevonedistat anticancer activity either alone or in combination with known anticancer drugs.[33–34] The current study aimed to illustrate whether pevonedistat, as a specific NAE inhibitor, would be able to mitigate CIS‐induced nephrotoxicity and, if so, the molecular mechanism of actions would be illustrated.

⦁ | MATERIALS AND METHODS

⦁ | Drugs and chemicals

MLN4924 was purchased from Active Biochemicals company and was prepared as a solution in a vehicle composed of 10% dimethyl sulfoxide (DMSO)/phosphate‐buffered saline (PBS). CIS was obtained from Mylan company as sterile vials.
⦁ | Animals and their treatment outlines

Swiss albino male mice each weighing 18–22 g were purchased from the experimental research center “MERCK,” Mansoura University, Egypt. All mice used in this study were maintained under standard conditions (22 ± 2°C temperature; 12–12 h light/dark cycle) with free access to standard laboratory food and purified drinking water. This study was approved by the Faculty of Pharmacy, Mansoura University, Egypt, and carried out in strict accordance with the ethical committee guidelines and recommendations (code number 2021‐300).
Mice were randomly assigned to four groups with 8 mice/group. Group 1: control group, in which mice were given intraperitoneal injection of control vehicle daily for three consecutive days; Group 2: pevonedistat group, in which mice were intraperitoneally injected with pevonedistat at a dose of 10 mg/kg daily for three consecutive days; Group 3: CIS group, in which mice were received a single intraperitoneal injection of CIS (25 mg/kg) at Day 0; Group 4: CIS + pevonedistat group, in which mice were received pevonedistat (10 mg/kg, ip) once daily for three con- secutive days started at Day 0 (1 h before single intraperitoneal injection of CIS as in CIS group) and continued for Day 1 and Day 2. In this study, the used doses/duration of treatment of CIS and pevonedistat were se- lected in the range reported in previous publications and based on pre- vious preliminary trials.[35–37]

⦁ | Sample collection

Seventy‐two hours after CIS injection , mice in all groups were sacrificed under deep anesthesia with thiopental (150 mg/kg, ip). Following cardiac puncture, blood samples were collected in plain marked tubes for bio- chemical analysis. Subsequently, sera were separated by centrifugation at 4°C, 3000 rpm for 10 min and were immediately used for creatinine and urea measurement. Then, kidneys were immediately excised and washed with chilled normal saline. The right kidney was fixed in 10% neutral buffered formalin for histopathological examinations. The left kidney was dissected into two parts. The first part was dipped then stored in a liquid nitrogen tank using RNase‐free cryotubes for RNA extraction and further molecular analyses. The second part was cut and immediately frozen in liquid nitrogen tanks for further biochemical markers examination using different techniques.

⦁ | Histopathological analysis

Five hematoxylin and eosin (H&E) stained slides from each group were examined using a light microscope, and digital pictures were picked up using the ImageScope program. Kidney tissue injury was assessed by scoring the percentage of tubular dilation, hyaline casts, tubular degeneration, and necrosis by examining 10 randomly chosen, nonoverlapping fields using a light microscope (×400 mag- nification). The kidney histopathology was blindly scored by two independent observers and lesions were classified on a scale from 0 to 5 according to severity as follows: 0, no damage; 1, mild damage,

involving <10% of the cortex and outer medulla; 2, moderate da- mage involving 10%–25% of the cortex and outer medulla; 3, severe damage involving >25%–50% of the cortex and outer medulla; 4, very severe damage involving >50%–75% of the cortex and outer medulla; and 5, extensive damage involving >75% damage of the cortex and outer medulla.[38]

⦁ | Kidney function assessment

Serum urea and creatinine concentrations were determined spec- trophotometrically and kinetically, respectively, using commercially available detection kits (Spectrum Diagnostics), according to the manufacturer’s instructions.

⦁ | Enzyme‐linked immunosorbent assay (ELISA) of cytokines in kidney homogenates

Lysates of renal tissue were prepared using ice‐cold radio- immunoprecipitation analysis (RIPA) lysis buffer (50 mM NaF, 1% Triton‐X, 0.1% sodium dodecyl sulfate [SDS], 150 mM NaCl, 2 mM EDTA, and 50 mM Tris‐HCl pH 7.4) in the presence of protease in- hibitor (Roche Diagnostics). Then, tissue lysates were centrifuged at 4000 rpm for 10 min (4°C) to collect clear supernatants. Bradford’s assay was utilized to estimate protein concentrations in the different tissue lysates. Renal mouse TNF‐α and IL‐6 expressions were ana- lyzed in the kidney homogenates using the corresponding ELISA Kit (BD Biosciences).

⦁ | Immunohistochemical analysis of IL‐1β and NF‐κB in renal tissue

The renal expressions of IL‐1β and NF‐κB were assessed using the immunohistochemistry technique. Harvested renal tissue was cleared in xylene, dehydrated in graded ethanol series, and embedded in paraffin wax. Approximately 4 µm thick kidney slices were cut and deparaffinized and rehydrated in xylene and decreasing ethanol gradients (100%, 90%, 70%, 50%, and 30%) for 2 min each. Sections were then blocked with 2% bovine serum albumin (BSA) made up in PBS for 30 min and antigen retrieval was carried out in 10 mM citrate buffer (pH 6.0) using a microwave. After the antigen retrieval pro- cedure, the sections were incubated overnight at 4°C with the fol- lowing primary monoclonal antibodies IL‐1β and NF‐κB that were purchased from Biolegend company with dilution 1:250. On the next day, the slides were then washed three times with PBS with 0.05% Tween‐20. Subsequently, specimens were incubated with HRP‐ conjugated secondary antibody for 2 h. The visual detection of the immune reaction was done by using a 3,3′‐diaminobenzidine‐ peroxidase substrate followed by counter‐staining with hematoxylin under a light microscope. Quantification of immunostaining was done by ImageJ software.
⦁ | Quantification of renal GSH and MDA levels in kidney homogenates

Renal tissues in appropriate weights and sizes were homogenized in a 10 ml cold buffer of 100 mM potassium phosphate buffer containing 2 mM EDTA, pH 7.4 per gram of tissue using a D1000 handheld homogenizer (Benchmark Scientific). The kidney homogenates were centrifuged at 4000 rpm for 15 min at 4°C using Centurion Scientific K3 Series Centrifuge. The resultant supernatant was used for the determination of GSH and MDA contents. Renal tissue GSH and MDA contents were spectrophotometrically assessed according to manufacturer instructions using detection kits provided by Bio Diagnostic company.

⦁ | Reverse‐transcription polymerase chain reaction (RT‐PCR) analysis of caspase‐3, Nrf2, A20, and β‐catenin genes

Total RNA was isolated from mice kidneys (∼20 mg) using Gene JET RNA Purification Kit (Thermo Fisher Scientific®) according to the manufacturer’s protocol. The quality and concentration of total ex- tracted RNA were detected spectrophotometrically using a nanodrop
ND‐2000 spectrophotometer. Only samples with a 260/280 ratio >2 and 260/230 ratio >1.8 can be passed to the next step. In total, 5 μg of total RNA was reverse‐transcribed to single‐stranded complementary DNA (cDNA) using Revert Aid H Minus Reverse Transcriptase (Thermo Fisher Scientific®). Caspase‐3, Nrf2, A20, and β‐catenin mRNA relative gene expressions were determined by PCR amplification step, which was carried out using 2× Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific) and Ste- pOnePlus Real‐Time PCR system (Applied Biosystem®). The specific PCR primer sets were designed by Primer 5.0 software and their sequences were as shown in Table 1.
The mouse β‐actin was implemented as a housekeeping gene and internal reference control to calculate fold change in target genes

TABLE 1 The primers sense and antisense sequences used for the amplification

β‐actin Forward

Reverse 5ʹ‐ACTATTGGCAACGAGCGGTT‐3ʹ
5ʹ‐CAGGATTCCATACCCAAGAAGGA‐3ʹ
Caspase‐3 Forward

Reverse 5ʹ‐GACCATACATGGGAGCAAGT‐3ʹ
5ʹ‐ CCTTCATCACCATGGCTTAGA ‐3ʹ
Nrf2 Forward

Reverse 5ʹ‐CGAGATATACGCAGGAGAGGTAAGA‐3ʹ
5ʹ‐ GCTCGACAATGTTCTCCAGCTT ‐3ʹ
A20 Forward

Reverse 5ʹ‐TGCCCAGTCTGTAGTCTTCG‐3ʹ
5ʹ‐AGTTGTTCAGCCATGGTCCT‐3ʹ
β‐catenin Forward

Reverse 5ʹ‐TGACACCTCCCAAGTCCTTT‐3ʹ
5ʹ‐TTGCATACTGCCCGTCAAT‐3ʹ

expression. Finally, mice caspase‐3, Nrf2, A20, and β‐catenin mRNA relative expressions were calculated according to the mathematical model introduced by Pfaffl, 2−ΔΔCt method.[39]

⦁ | Western blot analysis

Renal tissue was utilized to prepare total cell lysates using RIPA lysis buffer (50 mM NaF, 1% Triton‐X, 0.1% SDS, 150 mM NaCl, 2 mM EDTA, and 50 mM Tris‐HCl pH 7.4) in the presence of both protease inhibitors (Roche Diagnostics) and phosphatase inhibitor mixture II (Sigma‐Aldrich). Protein concentration was measured in the different samples using Bradford protein assay. Then, samples were prepared by mixing a fixed amount of each sample (30 µg) with Laemmli buffer that was composed of Tris (0.2 M), β‐mercaptoethanol (10%), glycerol (40%), and SDS (8%) at pH 8. The next step was denaturation of protein samples by heating at 95°C for 5 min and then samples were loaded on 12% gel to be electrophoresed according to their molecular weight using vertical sodium dodecyl sulfate–polyacrylamide gel electrophoresis. Then, the wet blotting method was applied to transfer separated samples from the gel to nitrocellulose membranes (0.2 µm porosity). Following blocking of the membranes by pre‐ incubation with 5% BSA for 1 h at room temperature, membranes were incubated with the required specific primary antibodies that were purchased from Sigma‐Aldrich (β‐actin, MW: 42 kDa), Cell Sig- naling Technology (caspase‐3 #9662; MW: 35 kDa and β‐catenin clone 6B3; MW: 92 kDa). The next day, membranes were incubated with the corresponding secondary antibodies after three washes with TBS‐Tween buffer. Anti‐mouse–HRP was used to detect bands for β‐actin protein (Dako‐Cytomation) while anti‐rabbit–HRP was used to detect bands of β‐catenin and caspase‐3 proteins (Cell Signaling Technology). The last step was membrane visualization that was done using an ECL Detection Kit for Western blot analysis according to the protocol of the manufacturer (Thermo Fisher Scientific).
⦁ | Statistical analysis

The program used to perform all the statistical analyses was Graph- Pad Prism 5.0. A one‐way analysis of variance test followed by the Tukey–Kramer multiple comparison test was used to compare be- tween the different groups. The differences were considered sig- nificant if p ≤ 0.05.

⦁ | RESULTS

⦁ | Pevonedistat improves kidney function and offsets CIS‐induced nephrotoxicity

CIS induced nephrotoxicity in mice as indicated by the significant increase in serum creatinine and urea levels compared with the control group (p ≤ 0.001) (Figure 1). However, animals treated with CIS in the presence of pevonedistat showed a significant decrease in both serum creatinine and urea levels compared with the CIS group (p ≤ 0.001).

⦁ | Pevonedistat attenuates renal tissue injury induced by CIS

Renal tissue histology was examined in the different groups using H&E staining. According to our results, control and pevonedistat groups showed a normal appearance of glomeruli and renal tubules (Figure 2A). On the contrary, the CIS group showed tubular dilation with hyaline casts, tubular degeneration, and necrosis. Interestingly, the CIS + pevonedistat group showed improvement in the renal tissue where very mild tubular degeneration and scant cast formation were detected. Statistical analysis of renal injury scores in each group re- vealed a significant increase in the CIS group compared with the control group (p ≤ 0.001) that was significantly decreased in the

FI GURE 1 Pevonedistat improves kidney function and offsets cisplatin (CIS)‐induced nephrotoxicity. Serum creatinine (A) and urea (B) were analyzed in the different mice treated groups. Bars represent mean ± SEM (n = 5–6 in each group). One‐way analysis of variance test followed by the Tukey–Kramer multiple comparison test was applied to compare between the different groups (ns, nonsignificant; ***p ≤ 0.001)

CIS + pevonedistat group compared with the CIS group (p ≤ 0.001) (Figure 2B).

⦁ | Pevonedistat decreases CIS‐induced upregulation of inflammatory mediators in renal tissue

As far as CIS‐induced renal injury was confirmed as indicated in the previous figures, it was interesting to analyze the expression of some inflammatory mediators in renal tissue such as IL‐6 and TNF‐α using the ELISA technique. According to our results, CIS induced a sig- nificant upregulation of both renal IL‐6 and TNF‐α protein expres- sions compared with the control group (p ≤ 0.001) (Figure 3A,B). On the contrary, the CIS + pevonedistat group showed a significant de- crease in both parameters, compared with the CIS group (p ≤ 0.001). Interestingly, pevonedistat treatment was able to decrease renal IL‐6 protein expression to be within its values in the control group. However, renal TNF‐α expression in the CIS + pevonedistat group was still significantly higher than the control group (p ≤ 0.05). In ad- dition, the anti‐inflammatory activity of pevonedistat was further confirmed by immunohistochemical analysis of IL‐1β and NF‐κB ex- pressions in renal tissue (Figure 3C–F). According to our results, the CIS group showed a significant increase in IL‐1β and NF‐κB expres- sions compared with the control group (p ≤ 0.001), while CIS + pevonedistat group showed a significant decrease in IL‐1β (p ≤ 0.01) and NF‐κB (p ≤ 0.001) expressions compared with the CIS group.
⦁ | Pevonedistat protects renal tissue against CIS‐induced caspase‐3 activation and downregulation of A20, β‐catenin, and Nrf2 genes

CIS induced apoptosis in renal tissue as indicated by the significant up- regulation of caspase‐3 gene expression in CIS group compared with the control group (p ≤ 0.001) (Figure 4A). Moreover, CIS induced a significant downregulation of A20, β‐catenin, and Nrf2 gene expressions compared with the control group (p ≤ 0.001). On the contrary, pevonedistat coun- teracted CIS‐induced apoptosis as indicated by the significant down- regulation of caspase‐3 gene expression in CIS + pevonedistat group compared with CIS group (p ≤ 0.001) that was still significantly higher than the control group (p ≤ 0.01). In addition, the CIS + pevonedistat group showed a significant upregulation in A20 (p ≤ 0.01), β‐catenin (p ≤ 0.001), and Nrf2 (p ≤ 0.001) genes compared with the CIS group. However, A20 and β‐catenin gene expressions were still significantly lower in the CIS + pevonedistat group than the control group (p ≤ 0.001 and p ≤ 0.05, respectively).
Moreover, Western blot analysis also revealed an induction of apoptosis in the CIS group as indicated by the detection of a clear band of cleaved caspase‐3 p19. On the contrary, pevonedistat mitigated CIS‐ induced apoptosis as indicated by the decrease in the expression of cleaved caspase‐3 product p19 which appeared as a weak band in the CIS + pevonedistat group compared with the CIS group (Figure 4B). Also, CIS induced depletion of β‐catenin protein expression while pevonedistat alone induced its clear accumulation compared with the control group.

FI GURE 2 Pevonedistat attenuates renal tissue injury induced by cisplatin (CIS). Renal histopathology (hematoxylin and eosin [H&E] staining,
×400) was analyzed in the different mice groups (A). Microscopic pictures of H&E stained renal sections show the status of glomeruli and tubules in control, pevonedistat, CIS, and CIS + pevonedistat groups. Renal sections from the group received CIS show marked tubular degeneration (black arrows), tubular dilation with hyaline casts formation (black arrowheads). Meanwhile, renal sections from the CIS + pevonedistat group show very mild tubular degeneration (black arrows) with scant casts formation (black arrowheads). Renal injury scores (B) were analyzed in the different mice treated groups. Bars represent mean ± SEM (n = 5–6 in each group). One‐way analysis of variance test followed by the Tukey–Kramer multiple comparison test was applied to compare between the different groups (ns, nonsignificant; ***p ≤ 0.001)

FI GURE 3 Pevonedistat decreases cisplatin (CIS)‐induced upregulation of inflammatory mediators in renal tissue. Renal expression levels of IL‐6
(A) and TNF‐α (B) were analyzed using the enzyme‐linked immunosorbent assay (ELISA) technique in the different treated mice groups. Bars represent mean ± SEM (n = 5–6 in each group). Renal expression of IL‐1β (C) and NF‐κB (E) were analyzed by immunohistochemical analysis of renal tissue and their quantifications were represented in (D) and (F), respectively. One‐way analysis of variance test followed by the Tukey–Kramer multiple comparison test was applied to compare between the different groups (ns, nonsignificant; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001)

However, pevonedistat was unable to recover β‐catenin protein expres- sion in the CIS + pevonedistat group.

⦁ | Pevonedistat protection against CIS‐induced nephrotoxicity is not related to antioxidant activity

In the current work, we analyzed lipid peroxidation marker MDA and GSH (the mother of all antioxidants) in renal tissue of the
different groups. According to our results, CIS induced oxidative stress in treated animals as indicated by a significant increase in the renal MDA level (p ≤ 0.05) and a significant decrease in the GSH level (p ≤ 0.001) compared with the control group (Figure 5). Although pevonedistat ameliorated CIS‐induced nephrotoxicity, it was unable to antagonize oxidative stress induced by CIS as indicated by the nonsignificant changes in the renal MDA and GSH levels in CIS + pevonedistat group compared with the CIS group.

FI GURE 4 Pevonedistat protects renal tissue against cisplatin (CIS)‐induced caspase‐3 activation and downregulation of A20, β‐catenin, and Nrf2 genes. Renal gene expression levels of caspase‐3, A20, β‐catenin, and Nrf2 were analyzed using the reverse‐transcription polymerase chain reaction (RT‐PCR) technique in the different treated mice groups (A). Renal expression of the indicated proteins was analyzed using the Western blot analysis technique in the different treated mice groups (B). Bars represent mean ± SEM (n = 5–6 in each group). One‐way analysis of variance test followed by the Tukey–Kramer multiple comparison test was applied to compare between the different groups (ns, nonsignificant; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001)

⦁ | DISCUSSION

CIS‐induced nephrotoxicity is related to its accumulation in renal tubules and ROS production that is associated with depletion of antioxidant enzymes and accumulation of the lipid peroxidation product MDA.[9–10] The accumulation of ROS leads to the
activation of several signaling pathways such as apoptosis and NF‐κB pathways that worsen the renal damage.[40–41] Pevone- distat is a specific NAE inhibitor that was reported by us and others with its ability to inhibit both classical and nonclassical NF‐κB pathways.[20,30,42–43] Although previous work detected the ability of pevonedistat to sensitize cancer cells to CIS

FI GURE 5 Pevonedistat protection against cisplatin (CIS)‐induced nephrotoxicity is not related to antioxidant activity. Renal malondialdehyde (MDA) (A) and glutathione (GSH) (B) expressions were analyzed in the different treated mice groups. Bars represent mean ± SEM (n = 5–6 in each group). One‐way analysis of variance test followed by the Tukey–Kramer multiple comparison test was applied to compare between the different groups (ns, nonsignificant; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001)

anticancer activity,[44–47] pevonedistat ability to mitigate CIS‐ induced nephrotoxicity was not investigated before.
In the current work, our results revealed the ability of CIS to induce apoptosis as indicated by upregulation of caspase‐3 gene expression and the appearance of the cleaved caspase‐3 p19. The ability of CIS to induce apoptosis may be attributed to p53 acti- vation and downregulation of the antiapoptotic protein Bcl‐2 leading to induction of the cleavage of caspase‐3 substrate PARP.[40,48] Moreover, CIS induced inflammation in renal tissue as indicated by the significant increase of several markers of in- flammation in renal tissue that was in agreement with previous studies.[37,49] Interestingly, our results revealed the anti‐ inflammatory activity of pevonedistat that may be attributed to its ability to inhibit both classical and nonclassical NF‐κB path- ways and the subsequent downstream of several inflammatory mediators as proved by previous studies.[30–31,50]
A20 is a signaling molecule that has anti‐inflammatory activity due to its ability to inhibit apoptosis and NF‐κB activation induced by TNF‐α.[51–52] Several studies revealed that overexpression of A20 protects against inflammation induced by different inflammatory diseases and tissue damage such as kidney damage.[52–55] Our results revealed that CIS induced downregulation of A20 gene expression in renal tissue that was counteracted by pevonedistat treatment that may reinforce the anti‐inflammatory role of A20 in renal injury. Moreover, the Wnt/β‐catenin signaling pathway is involved in dif- ferent processes such as organogenesis and disease progress.[56] Previous studies revealed that Wnt/β‐catenin signaling plays a vital role in the repair of renal tubules and tissue regeneration.[57–59] Likewise, we detected here a significant decrease in β‐catenin gene and protein expressions in CIS‐treated animals parallel with ne- phrotoxicity induction. Although pevonedistat was able to increase β‐catenin gene expression significantly in the CIS + pevonedistat group compared with the CIS group, it increased the basal β‐catenin

protein expression in pevonedistat group but it was unable to recover its protein expression in the presence of CIS in CIS + pevonedistat group. This controversy concerning pevonedistat effect on β‐catenin gene and protein expressions can be explained in view of the used dose and duration of treatment. The ability of pevonedistat to up- regulate the expression of β‐catenin might be attributed to its ability to inhibit NAE and the proteasomal degradation of this molecule that could explain its renal protective activity against CIS‐induced ne- phrotoxicity. The previous hypothesis is reinforced by a previous study that demonstrated the ability of proteasomal inhibition to offset CIS‐induced nephrotoxicity.[60]
Nrf2 is a signaling molecule that is involved in the antioxidant defense mechanism via regulation of antioxidant molecules.[61–62] Although pevonedistat treatment in the presence of CIS increased Nrf2 gene expression compared with the CIS group, pevonedistat was unable to counteract CIS‐induced accumulation of MDA and downregulation of GSH in kidney homogenates. The previous finding might be explained that pevonedistat only affects Nrf2 gene ex- pression without any effect on its nuclear translocation and its an- tioxidant activity that may require further studies. Thus, the protective effect of pevonedistat against CIS‐induced nephrotoxicity might be related to its anti‐inflammatory activity and its ability to downregulate the release of inflammatory mediators induced by ROS accumulation in the presence of CIS rather than by exhibiting a clear anti‐oxidant activity.
Thus conclusively, this study underscored the ability of pevonedistat to alleviate CIS‐induced nephrotoxicity that might be attributed to its anti‐inflammatory activity and its ability to suppress CIS‐induced caspase‐3 cleavage and down- regulation of A20, β‐catenin, and Nrf2 expressions in renal tissue. However, clinical studies are required to investigate the protec- tive effect of pevonedistat against the side effects of CIS in cancer patients.

ACKNOWLEDGMENTS
The authors thank Prof. Harald Wajant, Division of Molecular Internal Medicine, University Hospital Wuerzburg, Germany for his support with materials. The authors would also like to thank Dr. Walaa F. Awadin, Faculty of Veterinary Medicine, Mansoura University for her support in the histopathological and im- munohistochemical analysis.

CONFLICT OF INTERESTS
The authors declare that there are no conflict of interests.

DATA AVAILABILITY STATEMENT
Data are available on request from the authors.

ORCID
Mohamed El‐Mesery http://orcid.org/0000-0003-2649-3002

REFERENCES
⦁ G. M. Bedoschi, P. A. Navarro, K. H. Oktay, Panminerva Med. 2019,
61(1), 68.
⦁ M. Delessard, J. Saulnier, A. Rives, L. Dumont, C. Rondanino, N. Rives, Int. J. Mol. Sci. 2020, 21(4), 1454.
⦁ L. Y. Hu, W. L. Mi, G. C. Wu, Y. Q. Wang, Q. L. Mao‐Ying, Curr. Neuropharmacol. 2019, 17(2), 184.
⦁ N. Quryshi, L. E. Norwood Toro, K. Ait‐Aissa, A. Kong, A. M. Beyer,
Int. J. Mol. Sci. 2018, 19(3), 797.
⦁ K. K. Leslie, C. Koil, W. F. Rayburn, Obstet. Gynecol. Clin. North. Am.
2005, 32(4), 627.
⦁ Y. Yang, O. Adebali, G. Wu, C. P. Selby, Y. Y. Chiou, N. Rashid, J. Hu,
J. B. Hogenesch, A. Sancar, Proc. Natl. Acad. Sci. U.S.A. 2018, 115(21), E4777.
⦁ S. Dasari, P. B. Tchounwou, Eur. J. Pharmacol. 2014, 740, 364.
⦁ B. D. Sahu, M. Kuncha, G. J. Sindhura, R. Sistla, Phytomedicine 2013,
20(5), 453.
⦁ N. Ma, W. Wei, X. Fan, X. Ci, Front. Physiol. 2019, 10, 1419.
⦁ N. Pabla, Z. Dong, Kidney Int. 2008, 73(9), 994.
⦁ M. El‐Mesery, M. Al‐Gayyar, H. Salem, M. Darweish, A. El‐Mowafy,
Cell. Div. 2009, 4, 6.
⦁ A. M. El‐Mowafy, M. M. Al‐Gayyar, H. A. Salem, M. E. El‐Mesery,
M. M. Darweish, Phytomedicine 2010, 17(14), 1067.
⦁ T. Tanaka, T. Nakatani, T. Kamitani, Mol. Oncol. 2012, 6(3), 267.
⦁ M. Morimoto, T. Nishida, R. Honda, H. Yasuda, Biochem. Biophys. Res. Commun. 2000, 270(3), 1093.
⦁ I. R. Watson, M. S. Irwin, M. Ohh, Cancer Cell 2011, 19(2), 168.
⦁ M. J. Emanuele, A. E. Elia, Q. Xu, C. R. Thoma, L. Izhar, Y. Leng,
A. Guo, Y. N. Chen, J. Rush, P. W. Hsu, H.‐C. S. Yen, S. J. Elledge others, Cell 2011, 147(2), 459.
⦁ D. Guardavaccaro, M. Pagano, Oncogene 2004, 23(11), 2037.
⦁ Q. Gao, G. Y. Yu, J. Y. Shi, L. H. Li, W. J. Zhang, Z. C. Wang,
L. X. Yang, M. Duan, H. Zhao, X. Y. Wang, J. Zhou, S. J. Qiu,
L. S. Jeong, L. J. Jia, J. Fan, Oncotarget 2014, 5(17), 7820.
⦁ X. Wang, L. Li, Y. Liang, C. Li, H. Zhao, D. Ye, M. Sun, L. S. Jeong,
Y. Feng, S. Fu, L. Jia, X. Guo, BioMed Res. Int. 2014, 2014, 974309.
⦁ M. El‐Mesery, T. Rosenthal, H. Rauert‐Wunderlich, M. Schreder,
T. Stühmer, E. Leich, A. Schlosser, M. Ehrenschwender, H. Wajant,
D. Siegmund, Cell Death Dis. 2019, 10(8), 611.
⦁ J. J. Lin, M. A. Milhollen, P. G. Smith, U. Narayanan, A. Dutta, Cancer Res. 2010, 70(24), 10310.
⦁ M. A. Milhollen, T. Traore, J. Adams‐Duffy, M. P. Thomas,
⦁ J. Berger, L. Dang, L. R. Dick, J. J. Garnsey, E. Koenig,
S. P. Langston, M. Manfredi, U. Narayanan, M. Rolfe, L. M. Staudt,
T. A. Soucy, J. Yu, J. Zhang, J. B. Bolen, P. G. Smith, Blood 2010,
116(9), 1515.
⦁ T. A. Soucy, P. G. Smith, M. A. Milhollen, A. J. Berger, J. M. Gavin,
S. Adhikari, J. E. Brownell, K. E. Burke, D. P. Cardin, S. Critchley,
C. A. Cullis, A. Doucette, J. J. Garnsey, J. L. Gaulin, R. E. Gershman,
A. R. Lublinsky, A. McDonald, H. Mizutani, U. Narayanan,
E. J. Olhava, S. Peluso, M. Rezaei, M. D. Sintchak, T. Talreja,
M. P. Thomas, T. Traore, S. Vyskocil, G. S. Weatherhead, J. Yu,
J. Zhang, L. R. Dick, C. F. Claiborne, M. Rolfe, J. B. Bolen, S. P. Langston, Nature 2009, 458(7239), 732.
⦁ A. R. E. El‐Mesery, M. El‐Karef, A. Eissa LA, Can. J. Physiol. Pharmacol. 2018, 96(12), 1218.
⦁ N. A. Abd Elrazik, M. El‐Mesery, A. El‐Karef, L. A. Eissa,
A. M. El Gayar, Nutr. Cancer 2021, 1.
⦁ M. El‐Mesery, A. Seher, M. El‐Shafey, M. El‐Dosoky, F. A. Badria,
Biotechnol. Appl. Biochem. 2020.
⦁ M. El‐Mesery, M. E. Shaker, A. Elgaml, Exp. Biol. Med. (Maywood)
2016, 241(18), 2015.
⦁ S. A. Helmy, M. El‐Mesery, A. El‐Karef, L. A. Eissa, A. M. El Gayar,
Chem.–Biol. Interact. 2018, 279, 84.
⦁ S. A. Helmy, M. El‐Mesery, A. El‐Karef, L. A. Eissa, A. M. El Gayar,
Life Sci. 2019, 233, 116673.
⦁ M. El‐Mesery, A. Seher, T. Stühmer, D. Siegmund, H. Wajant, Br. J. Pharmacol. 2015, 172(5), 1222.
⦁ M. J. J. Scheurer, R. C. Brands, M. El‐Mesery, S. Hartmann,
U. D. A. Müller‐Richter, A. C. Kübler, A. Seher, Int. J. Mol. Sci. 2019,
20(6), 1306.
⦁ Y. Zeng, Y. S. Iv, Q. H. Pan, Y. G. Zhou, H. Li, Oncol. Lett. 2019, 18(3), 2724.
⦁ A. C. Lockhart, T. M. Bauer, C. Aggarwal, C. B. Lee, R. D. Harvey,
R. B. Cohen, F. Sedarati, T. K. Nip, H. Faessel, A. B. Dash,
B. J. Dezube, D. V. Faller, A. Dowlati, Invest. New Drugs 2019, 37(1), 87.
⦁ R. T. Swords, H. P. Erba, D. J. DeAngelo, D. L. Bixby, J. K. Altman,
M. Maris, Z. Hua, S. J. Blakemore, H. Faessel, F. Sedarati,
B. J. Dezube, F. J. Giles, B. C. Medeiros, Br. J. Haematol. 2015,
169(4), 534.
⦁ R. Hao, Y. Song, R. Li, Y. Wu, X. Yang, X. Li, F. Qian, R. D. Ye, L. Sun,
Am. J. Physiol.: Lung Cell. Mol. Physiol. 2019, 316(6), L1070.
⦁ C. A. Reihe, N. Pekas, P. Wu, X. Wang, Am. J. Cardiovasc. Dis. 2017,
7(6), 134.
⦁ M. E. Shaker, A. A. Shaaban, M. M. El‐Shafey, M. E. El‐Mesery,
Toxicol. Appl. Pharmacol. 2020, 398, 115018.
⦁ I. Potočnjak, D. Broznić, M. Kindl, M. Kropek, S. Vladimir‐Knežević,
R. Domitrović, Food Chem. Toxicol. 2017, 107(Pt A), 215.
⦁ M. W. Pfaffl, Nucleic Acids Res. 2001, 29(9), e45.
⦁ M. Jiang, Z. Dong, J. Pharmacol. Exp. Ther. 2008, 327(2), 300.
⦁ X. Yu, X. Meng, M. Xu, X. Zhang, Y. Zhang, G. Ding, S. Huang,
A. Zhang, Z. Jia, EBioMedicine 2018, 36, 266.
⦁ M. El‐Mesery, M. Anany, S. M. Hesham, M. E. Shaker, Arch. Biochem. Biophys. 2020, 691, 108513.
⦁ H. Sun, W. Yao, K. Wang, Y. Qian, H. Chen, Y. S. Jung, Virology
2018, 514, 230.
⦁ I. L. Ho, K. L. Kuo, S. H. Liu, H. C. Chang, J. T. Hsieh, J. T. Wu,
C. K. Chiang, W. C. Lin, Y. C. Tsai, C. T. Chou, C. H. Hsu, Y. S. Pu, C. S. Shi, K. H. Huang, Sci. Rep. 2015, 5, 16948.
⦁ A. A. Jazaeri, E. Shibata, J. Park, J. L. Bryant, M. R. Conaway,
S. C. Modesitt, P. G. Smith, M. A. Milhollen, A. J. Berger, A. Dutta,
Mol. Cancer Ther. 2013, 12(10), 1958.
⦁ S. Lin, Z. Shang, S. Li, P. Gao, Y. Zhang, S. Hou, P. Qin, Z. Dong, T. Hu, P. Chen, Oncol. Lett. 2018, 15(2), 2583.
⦁ W. C. Lin, K. L. Kuo, C. S. Shi, J. T. Wu, J. T. Hsieh, H. C. Chang,
S. M. Liao, C. T. Chou, C. K. Chiang, W. S. Chiu, T. Y. Chiu, Y. S. Pu,
I. L. Ho, Z. H. Wang, S. C. Chang, S. H. Liu, Y. M. Jeng, K. H. Huang,
Am. J. Cancer Res. 2015, 5(11), 3350.

10 of 10 |

⦁ T. Pecere, F. Sarinella, C. Salata, B. Gatto, A. Bet, F. Dalla Vecchia,
A. Diaspro, M. Carli, M. Palumbo, G. Palù, Int. J. Cancer 2003, 106(6), 836.
⦁ L. A. Peres, A. D. da Cunha Jr., J. Bras. Nefrol. 2013, 35(4), 332
⦁ Z. Fu, W. Liao, H. Ma, Z. Wang, M. Jiang, X. Feng, W. Zhang, Am. J. Transl. Res. 2019, 11(5), 2830.
⦁ L. Catrysse, L. Vereecke, R. Beyaert, G. van Loo, Trends Immunol.
2014, 35(1), 22.
⦁ L. Wei, X. Zhang, Q. Ye, Y. Yang, X. Chen, Mol. Med. Rep. 2017,
16(2), 1486.
⦁ M. B. Arvelo, J. T. Cooper, C. Longo, S. Daniel, S. T. Grey, J. Mahiou,
E. Czismadia, G. Abu‐Jawdeh, C. Ferran, Hepatology 2002, 35(3), 535.
⦁ J. Gui, Y. Yue, R. Chen, W. Xu, S. Xiong, PLOS One 2012, 7(9), e46515.
⦁ M. Li, X. Shi, T. Qian, J. Li, Z. Tian, B. Ni, F. Hao, Int. J. Clin. Exp. Med.
2015, 8(10), 17430.
⦁ D. Zhou, R. J. Tan, H. Fu, Y. Liu, Lab. Invest. 2016, 96(2), 156.
⦁ S. L. Lin, B. Li, S. Rao, E. J. Yeo, T. E. Hudson, B. T. Nowlin, H. Pei,
L. Chen, J. J. Zheng, T. J. Carroll, J. W. Pollard, A. P. McMahon,
R. A. Lang, J. S. Duffield, Proc. Natl. Acad. Sci. U.S.A. 2010, 107(9), 4194.
⦁ X. Wang, E. A. Grunz‐Borgmann, A. R. Parrish, Toxicol. Sci. 2014,
141(1), 254.
⦁ D. Zhou, Y. Li, L. Lin, L. Zhou, P. Igarashi, Y. Liu, Kidney Int. 2012,
82(5), 537.
⦁ L. Liu, C. Yang, C. Herzog, R. Seth, G. P. Kaushal, Biochem. Pharmacol. 2010, 79(2), 137.
⦁ N. F. Abo El‐Magd, M. El‐Mesery, A. El‐Karef, M. M. El‐Shishtawy,
Life Sci. 2018, 193, 159.
⦁ A. I. Casas, V. T. Dao, A. Daiber, G. J. Maghzal, F. Di Lisa,
N. Kaludercic, S. Leach, A. Cuadrado, V. Jaquet, T. Seredenina,
K. H. Krause, M. G. López, R. Stocker, P. Ghezzi, H. H. Schmidt,
Antioxid. Redox Signaling 2015, 23(14), 1171.

How to cite this article: Y. M. El‐Far, M. El‐Mesery,
J. Biochem. Mol. Toxicol. 2021, e22908. https://doi.org/10.1002/jbt.22908